Restriction digests of the clone give the following sizes (kb): EcoRI--2.7, 2.1, 0.4, 0.24; PstI--2.5, 1.8, 1.0; PvuII--5.4; SphI--4.6, 0.9; SmaI/XbaI--4.4, 1.1. Insert contains the following restriction sites (approximate kb from the 5' end): EcoRI--0.11, 0.56; PstI--0.6; PvuII--0.38, 0.54; SphI--0.62. Contains the complete coding sequence plus portions of the 5' and 3' untranslated regions. This clone varies from other published sequence(s): GenBank records X62429, D01114. The aa sequence differences determined by GenBank X72215 are: Q4R, D227Y. The ends of the PIT1-specific portions of the primers used to amplify this sequence correspond to nt 56-1046 of GenBank record D01114. In this record, the coding region extends from nt 126-1001. Insert was amplified using the following primers: 5'CCCCCCGGGAGACAGTAATATAATAA 3'(5' untranslated region) and 5'CCCTCTAGAGAAGGAATGAAACGGG 3' (3' untranslated region). |
